Q0075 (gene) Saccharomyces cerevisiae

Feature Details
Name Q0075
Unique Name Q0075
Internal ID 44107
Type gene
Organism Saccharomyces cerevisiae (yeast)
Cross References
External references for this gene
Dababase Accession
SGD S000007266
Properties
Properties for the feature 'Q0075' include:
Property Name Value
Orf classification Uncharacterized
Display Protein of unknown function
Gene AI5_BETA
Note Protein of unknown function, encoded within an intron of the mitochondrial COX1 gene; translational initiation codon is predicted to be ATA rather than ATG
Annotated Terms
The following terms have been associated with this gene:

Biological Process

Term Definition
GO:0008150 biological_process

Cellular Component

Term Definition
GO:0005739 mitochondrion

Molecular Function

Term Definition
GO:0003674 molecular_function
Synonyms
The feature 'Q0075' has the following synonyms
Synonym
AI5_BETA
Annotated Sequence
Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>Q0075 chrmt:24156..25255 +
ATATTAATATTATTAATAATAATTTTAACTAATAATAAAGTTTTTATAGA
AACTTTATATTATTATTTAATATTTAATTTTCAATTAATATCTCCTTTTG
GGGTTCCGGTCCCTGGTCCGGCCCCCGAAACTAAAGATATTAAGAATTTA
TATGAATCAATTATAAATAATTATATTAATATTTTAAATAAATATCTTAT
TAATATTAATAAAGATAATATTAATAAATTAAAATTTTTAGATAATTATA
CTGAAGAAGAAAAAGGTTATTATTTATCTGGATTATTTGAAGGAGATGGT
AATATTTATACTAGATGTTTTTCAATTACTTTTTCTTTAGAAGATGTTTT
ATTAGCTAATTATTTATGTCTTTATTTTAAAATTGGTCATATTACAGCTA
AATATAATTTTAATAAAGAATTAACAGCTGTTAAATGAAATATTATAAAA
AAAAAAGAACAAGAAGTATTTATAAATTATATTAATGGTAAATTATTAAC
ATATAAAAGATATGATCAATATTTTAAATATAATTTTAATAATCGTTTAA
ATATTAAATTATTAAAACCTAAAGAATTTGATTTACTATTAAATCCTTGA
TTAACAGGTTTTAATGATGCTGATGGTTATTTTTATCTAGGTTTTCAAAA
ACATAAAAATAGTCAATGATTAAAATTTCATTTAGAATTATCACAAAAAG
ATAGTTATATTTTAGTCCGGCCCGCCCCCGCGGGGCGGACCCCAAAGGAG
ATATTATTAAAAAATATTTTAAACTTGGTGGTATTTTAAAAAGAGATTAT
AAATCTGGTGCTACAGCTTATATTTATAAAGCTCAATCATCAAAAGCTAT
AAAACCTTTTATTGAATATTTTAATAATTATCAACCATTAAGTCTTAGAA
GATATAAACAATATTTATTATTAAATATTGCTTACTTATTAAAATTAAAT
AAATTACATATATTACTTAATTCTTTATTAATATTAAAAGAATTAATATT
ATTACAAAGTGTTAAAAATATATCTTTAGAAATAAAAAATGAATTAAATA
ATAGAGTTAAAATTATTATTAATAAACTTCATTATAACAATATCGAATAA
Relationships

The following mRNA feature(s) are part of this gene:

Feature Name Unique Name Species Type
Q0075_mRNA Q0075_mRNA Saccharomyces cerevisiae mRNA


Alignments
The following features are aligned to this gene
Aligned Feature Feature Type Alignment Location
chrmt chromosome chrmt:24156..25255 +
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
cellular_component GO:0005739 mitochondrion
molecular_function GO:0003674 molecular_function
Resources