Q0070 (gene) Saccharomyces cerevisiae

Feature Details
Name Q0070
Unique Name Q0070
Internal ID 44106
Type gene
Organism Saccharomyces cerevisiae (yeast)
Cross References
External references for this gene
Dababase Accession
SGD S000007265
Properties
Properties for the feature 'Q0070' include:
Property Name Value
Orf classification Verified
Display Endonuclease I-SceIV
Gene AI5_ALPHA
Note Endonuclease I-SceIV, involved in intron mobility; encoded by a mobile group I intron within the mitochondrial COX1 gene
Annotated Terms
The following terms have been associated with this gene:

Biological Process

Term Definition
GO:0006316 movement of group I intron

Cellular Component

Term Definition
GO:0005739 mitochondrion

Molecular Function

Term Definition
GO:0004519 endonuclease activity
Synonyms
The feature 'Q0070' has the following synonyms
Synonym
AI5_ALPHA
Annotated Sequence
Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>Q0070 chrmt:13818..23167 +
ATGGTACAAAGATGATTATATTCAACAAATGCAAAAGATATTGCAGTATT
ATATTTTATGTTAGCTATTTTTAGTGGTATGGCAGGAACAGCAATGTCTT
TAATCATTAGATTAGAATTAGCTGCACCTGGTTCACAATATTTACATGGT
AATTCACAATTATTTAATGGTGCGCCTCTCAGTGCGTATATTTCGTTGAT
GCGTCTAGCATTAGTATTATGAATCATCAATAGATACTTAAAACATATGA
CTAACTCAGTAGGGGCTAACTTTACGGGGACAATAGCATGTCATAAAACA
CCTATGATTAGTGTAGGTGGAGTTAAGTGTTACATGGTTAGGTTAACGAA
CTTCTTACAAGTCTTTATCAGGATTACAATTTCCTCTTATCATTTGGATA
TAGTAAAACAAGTTTGATTATTTTACGTTGAGGTAATCAGATTATGATTC
ATTGTTTTAGATAGCACAGGCAGTGTGAAAAAGATGAAGGACCTAAATAA
CACAAAAGGAAATACGAAAAGTGAGGGATCAACTGAAAGAGGAAACTCTG
GAGTTGACAGAGGTATAGTAGTACCGAATACTCAAATAAAAATGAGATTT
TTAAATCAAGTTAGATACTATTCAGTAAATAATAATTTAAAAATAGGGAA
GGATACCAATATTGAGTTATCAAAAGATACAAGTACTTCGGACTTGTTAG
AATTTGAGAAATTAGTAATAGATAATATAAATGAGGAAAATATAAATAAT
AATTTATTAAGTATTATAAAAAACGTAGATATATTAATATTAGCATATAA
TAGAATTAAGAGTAAACCTGGTAATATAACTCCAGGTACAACATTAGAAA
CATTAGATGGTATAAATATAATATATTTAAATAAATTATCAAATGAATTA
GGAACAGGTAAATTCAAATTTAAACCCATGAGAATAGTTAATATTCCTAA
ACCTAAAGGTGGTATAAGACCTTTAAGTGTAGGTAATCCAAGAGATAAAA
TTGTACAAGAAGTTATAAGAATAATTTTAGATACAATTTTTGATAAAAAG
ATATCAACACATTCACATGGTTTTAGAAAGAATATAAGTTGTCAAACAGC
AATTTGAGAAGTTAGAAATATATTTGGTGGAAGTAATTGATTTATTGAAG
TAGACTTAAAAAAATGTTTTGATACAATTTCTCATGATTTAATTATTAAA
GAATTAAAAAGATATATTTCAGATAAAGGTTTTATTGATTTAGTATATAA
ATTATTAAGAGCTGGTTATATTGATGAGAAAGGAACTTATCATAAACCTA
TATTAGGTTTACCTCAAGGATCATTAATTAGTCCTATCTTATGTAATATT
GTAATAACATTGGTAGATAATTGATTAGAAGATTATATTAATTTATATAA
TAAAGGTAAAGTTAAAAAACAACATCCTACATATAAAAAATTATCAAGAA
TAATTGCAAAAGCTAAAATATTTTCGACAAGATTAAAATTACATAAAGAA
AGAGCTAAAGGCCCACTATTTATTTATAATGATCCTAATTTCAAGAGAAT
AAAATACGTTAGATATGCAGATGATATTTTAATTGGGGTATTAGGTTCAA
AAAATGATTGTAAAATAATCAAAAGAGATTTAAACAATTTTTTAAATTCA
TTAGGTTTAACTATAAATGAAGAAAAAACTTTAATTACTTGTGCAACTGA
ACTACCAGCAAGATTTTTAGGTTATAATATTTCAATTACACCTTTAAAAA
GAATACCTACAGTTACTAAACTAATTAGAGGTAAACTTATTAGAAGTAGA
AATACAACTAGACCTATTATTAATGCACCAATTAGAGATATTATCAATAA
ATTAGCTACTAATGGATATTGTAAGCATAATAAAAATGGTAGAATAGGAG
TGCCTACAAGAGTAGGTAGATGACTATATGAAGAACCTAGAACAATTATT
AATAATTATAAAGCGTTAGGTAGAGGTATCTTAAATTATTATAAATTAGC
TACTAATTATAAAAGATTAAGAGAAAGAATCTATTACGTATTATATTATT
CATGTGTATTAACTTTAGCTAGTAAATATAGATTAAAAACAATAAGTAAA
ACTATTAAAAAATTTGGTTATAATTTAAATATTATTGAAAATGATAAATT
AATTGCCAATTTTCCAAGAAATACTTTTGATAATATCAAAAAAATTGAAA
ATCATGGTATATTTATATATATATCAGAAGCTAAAGTAACTGATCCTTTT
GAATATATCGATTCAATTAAATATATATTACCTACAGCTAAAGCTAATTT
TAATAAACCTTGTAGTATTTGTAATTCAACTATTGATGTAGAAATACATC
ATGTTAAACAATTACATAGAGGTATATTAAAAGCACTTAAAGATTATATT
CTAGGTAGAATAATTACCATAAACAGAAAACAAATTCCATTATGTAAACA
ATGTCATATTAAAACACATAAAAATAAATTTAAAAATATAGGACCTGGTA
TATAAAATCTATTATTAATGATACTCAATATGGAAAGCCGTATGATGGGA
AACTATCACGTACGGTTTGGGAAAGGCTCTTTAACACGTGGCAACATAGG
TTAATTTGCTATTTCATTTTTAGTAGTTGGTCATGCTGTATTAATGATTT
TCTGTGCGCCGTTTCGCTTAATTTATCACTGTATTGAAGTGTTAATTGAT
AAACATATCTCTGTTTATTCAATTAATGAAAACTTTACCGTATCATTTTG
GTTCTGATTATTAGTAGTAACATACATAGTATTTAGATACGTAAACCATA
TGGCTTACCCAGTTGGGGCCAACTCAACGGGGACAATAGCATGCCATAAA
AGCGCTGGAGTAAAACAGCCAGCGCAAGGTAAGAACTGTCCGATGGCTAG
GTTAACGAATTCCTGTAAAGAATGTTTAGGGTTCTCATTAACTCCTTCCC
ACTTGGGGATTGTGATTCATGCTTATGTATTGGAAGAAGAGGTACACGAG
TTAACCAAAAATGAATCATTAGCTTTAAGTAAAAGTTGACATTTGGAGGG
CTGTACGAGTTCAAATGGAAAATTAAGAAATACGGGATTGTCCGAAAGGG
GAAACCCTGGGGATAACGGAGTCTTCATAGTACCCAAATTTAATTTAAAT
AAAGTGAGATACTTTAGTACTTTATCTAAATTAAATGCAAGGAAGGAAGA
CAGTTTAGCGTATTTAACAAAGATTAATACTACGGATTTTTCCGAGTTAA
ATAAATTAATAGAAAATAATCATAATAAACTTGAAACCATTAATACTAGA
ATTTTAAAATTAATGTCAGATATTAGAATGTTATTAATTGCTTATAATAA
AATTAAAAGTAAGAAAGGTAATATATCTAAAGGTTCTAATAATATTACCT
TAGATGGGATTAATATTTCATATTTAAATAAATTATCTAAAGATATTAAC
ACTAATATGTTTAAATTTTCTCCGGTTAGAAGAGTTGAAATTCCTAAAAC
ATCTGGAGGATTTAGACCTTTAAGTGTTGGAAATCCTAGAGAAAAAATTG
TACAAGAAAGTATGAGAATAATATTAGAAATTATCTATAATAATAGTTTC
TCTTATTATTCTCATGGATTTAGACCTAACTTATCTTGTTTAACAGCTAT
TATTCAATGTAAAAATTATATGCAATACTGTAATTGATTTATTAAAGTAG
ATTTAAATAAATGCTTTGATACAATTCCACATAATATGTTAATTAATGTA
TTAAATGAGAGAATCAAAGATAAAGGTTTCATAGACTTATTATATAAATT
ATTAAGAGCTGGATATGTTGATAAAAATAATAATTATCATAATACAACTT
TAGGAATTCCTCAAGGTAGTGTTGTCAGTCCTATTTTATGTAATATTTTT
TTAGATAAATTAGATAAATATTTAGAAAATAAATTTGAGAATGAATTCAA
TACTGGAAATATGTCTAATAGAGGTAGAAATCCAATTTATAATAGTTTAT
CATCTAAAATTTATAGATGTAAATTATTATCTGAAAAATTAAAATTGATT
AGATTAAGAGACCATTACCAAAGAAATATGGGATCTGATAAAAGTTTTAA
AAGAGCTTATTTTGTTAGATATGCTGATGATATTATCATTGGTGTAATGG
GTTCTCATAATGATTGTAAAAATATTTTAAACGATATTAATAACTTCTTA
AAAGAAAATTTAGGTATGTCAATTAATATAGATAAATCCGTTATTAAACA
TTCTAAAGAAGGAGTTAGTTTTTTAGGGTATGATGTAAAAGTTACACCTT
GAGAAAAAAGACCTTATAGAATGATTAAAAAAGGTGATAATTTTATTAGG
GTTAGACATCATACTAGTTTAGTTGTTAATGCCCCTATTAGAAGTATTGT
AATAAAATTAAATAAACATGGCTATTGTTCTCATGGTATTTTAGGAAAAC
CCAGAGGGGTTGGAAGATTAATTCATGAAGAAATGAAAACCATTTTAATG
CATTACTTAGCTGTTGGTAGAGGTATTATAAACTATTATAGATTAGCTAC
CAATTTTACCACATTAAGAGGTAGAATTACATACATTTTATTTTATTCAT
GTTGTTTAACATTAGCAAGAAAATTTAAATTAAATACTGTTAAGAAAGTT
ATTTTAAAATTCGGTAAAGTATTAGTTGATCCTCATTCAAAAGTTAGTTT
TAGTATTGATGATTTTAAAATTAGACATAAAATAAATATAACTGATTCTA
ATTATACACCTGATGAAATTTTAGATAGATATAAATATATGTTACCTAGA
TCTTTATCATTATTTAGTGGTATTTGTCAAATTTGTGGTTCTAAACATGA
TTTAGAAGTACATCACGTAAGAACATTAAATAATGCTGCCAATAAAATTA
AAGATGATTATTTATTAGGTAGAATGATTAAGATAAATAGAAAACAAATT
ACTATCTGTAAAACATGTCATTTTAAAGTTCATCAAGGTAAATATAATGG
TCCAGGTTTATAATAATTATTATACTATTAAATATGCGTTAAATGGAGAG
CCGTATGATATGAAAGTATCACGTACGGTTCGGAGAGGGCTCTTTTATAT
GAATGTTATTACATTCAGATAGGTTTGCTACTCTACTCTTAGTAATGCCT
GCTTTAATTGGAGGTTTTGGTAACCAAAAAAGATATGAAAGTAATAATAA
TAATAATCAAGTAATAGAAAATAAAGAATATAATTTAAAATTAAATTATG
ATAAGTTGGGACCTTATTTAGCTGGATTAATTGAAGGTGATGGAACTATT
CTAGTTCAAAATTCATCTTCAATAAAAAAATCTAAATATAGACCGTTAAT
TGTTGTAGTATTTAAATTAGAAGATTTAGAATTAGCTAATTATTTATGTA
ATTTAACTAAATGTGGAAAAGTGTATAAAAAAATTAATCGTAATTATGTA
TTATGACTTATTCATGATTTAAAAGGTGTATATACATTATTAAATATTAT
TAATGGATATATGAGAACACCTAAATATGAAGCATTTGTTAGAGGTGCTG
AATTTATAAATAATTATATTAATTCAACAACAATTCTACATAATAAATTA
AAAAATATAGATAATATTAAAATTAAACCATTAGATACATCAGATATTGG
TTCAAACGCTTGATTAGCTGGTATGACAGATGCAGATGGTAATTTTTCTA
TTAATTTAATAAATGGTAAAAATCGTTCTAGTAGAGCAATGCCTTATTAT
TGTTTAGAATTAAGACAAAATTATCAAAAAAATTCTAATAATAATAATAT
TAATTTTTCTTATTTTTATATTATGTCTGCAATTGCACTATATTTTAATG
TTAATTTATATAGTAGAGAACGTAATTTAAATTTATTAGTATCTCTTAAT
AATACGTATAAACTATATTATAGTTATAAAGTAATAGTGGCTAATCTATA
TAAAAATATTAAAGTAATAGAATACTTTAATAAATATTCTTTATTATCAT
CTAAACACTTAGATTTTTTAGATTGATCTAAATTAGTTATTTTAATTAAT
AATGAGGGTCAAAGTATAAAACTTAATGGTAGTTGAGAATTAGGTATAAA
TTTACGTAAAGATTATAATAAAACTAGAACTACGTTTACTTGATCTCATT
TAAAAAATACATATTTAGAAAATAAATAAATAAATTATTATTACTTTCTT
CCCCTCCGAATCCGTAATATATTTACGGATATATAATCTCGTAGTGTAAA
AGGTGTAACGAGATTATTAATAAGTTGCCGTAATATATTGTAAAATATAT
TATTATTACAACACTATATGCGGGAAAACCCTAAAGTCATAATATAATAT
TATCCCCACGAGGGCCACACATGTGTGGCCCTCGCGGGGTATGGTAAATT
TAATTAAGTTATAAATGTACTATAGTATTAAAAATTATTATGAATAATTT
CCCCACCCCCATGCGAAGCATGGGGGGGGGTATAAGTATGGACAATCCGC
AGGAAACCAAATAATAATTAATATCCTGAAACAAAGTAAGTGAAGGAGAT
ATCTTAAAATATATATAATATATATTTTATAAATTATTATGTAGGATCCT
CAGAGACTACACGTGTTGCACCCATTATATTATGTATAATGGGTTGAAGA
TATAGTCCAAATATAATTGAAAGATTATAATAAAATGAACTATTTATTAC
CATTAATAATTGGAGCTACAGATACAGCATTTCCAAGAATTAATAACATT
GCTTTTTGAGTATTACCTATGGGGTTAGTATGTTTAGTTACATCAACTTT
AGTAGAATCAGGTGCTGGTACAGGGTGAACTGTCTATCCACCATTATCAT
CTATTCAGGCACATTCAGGACCTAGTGTAGATTTAGCAATTTTTGCATTA
CATTTAACATCAATTTCATCATTATTAGGTGCTATTAATTTCATTGTAAC
AACATTAAATATGAGAACAAATGGTATGACAATGCATAAATTACCATTAT
TTGTATGATCAATTTTCATTACAGCGTTCTTATTATTATTATCATTACCT
GTATTATCTGCTGGTATTACAATGTTATTATTAGATAGAAACTTCAATAC
TTCATTCTTTGAAGTATCAGGAGGTGGTGACCCAATCTTATACGAGCATT
TATTTTGATTCTTTGGTCAAACAGTGGCCCTTATTATTATATTAATAATA
TATAATGATATGCATTTTTCTAAATGCTGGAAATTATTAAAAAAATGAAT
TACAAATATTATAAGTCTATTATTTAAAGCCTTATTTGTAAAAATATTCA
TATCTTATAATAATCAGCAGGATAAGATAATAAATAATCTTATATTAAAA
AAAGATAATATTAAAAGATCCTCAGAGACTACAAGAAAAATATTAAATAA
TTCAATAAATAAAAAATTTAATCAATGATTAGCTGGATTAATTGATGGTG
ATGGATATTTTGGTATTGTAAGTAAGAAATATGTATCATTAGAAATTCTA
GTAGCATTAGAAGATGAAATAGCTTTAAAAGAAATTCAAAATAAATTTGG
TGGTTCTATTAAATTAAGATCAGGTGTAAAAGCTATTAGATATAGATTAC
TTAATAAAACTGGTATAATTAAATTAATTAATGCAGTTAATGGTAATATT
AGAAATACTAAAAGATTAGTACAATTTAATAAAGTTTGTATTTTATTAGG
TATTGATTTTATTTATCCAATTAAATTAACTAAAGATAATAGTTGATTTG
TTGGATTTTTTGATGCTGATGGTACAATTAATTATTCATTTAAAAATAAT
CATCCTCAATTAACAATTTCTGTAACTAATAAATATTTACAAGATGTACA
AGAATATAAAAATATTTTAGGTGGTAATATTTATTTTGATAAATCACAAA
ATGGTTATTATAAATGATCCATTCAATCAAAAGATATAGTATTAAATTTT
ATTAATGATTATATTAAAATAAATCCATCAAGAACACTAAAAATAAATAA
ATTATATTTAAGTAAAGAATTTTATAATTTAAAAGAATTAAAAGCTTATA
ATAAATCTTCTGATTCAATACAATATAAAGCATGATTAAATTTTGAAAAT
AAATGAAAAAATAAATAAATTATTTAATAAAGATATAGTCCAAATTATAT
ATATATAATATATATATATATAACAAGCACCCTGAAGTATATATTTTAAT
TATTCCTGGATTTGGTATTATTTCACATGTAGTATCAACATATTCTAAAA
AACCTGTATTTGGTGAAATTTCAATGGTATATGCTATGGCTTCAATTGGA
TTATTAGGATTCTTAGTATGATCACATCATATGTATATTGTAGGATTAGA
TGCAGATCTTAGAGCATATTTCCTATCTGCACTAATGATTATTGCAATTC
CAACAGGAATTAAAATTTTCTCATGATTAATAAATCCCTTTAGCAAGGAT
AAAAATAAAAATAAAAATAAAAAGTTGATCAGAAATTATCAAAAAATAAA
TAATAATAATATAATAAAAACATATTTAAATAATAATAATATAATTATAA
TAAATATATATAAAGGTAATTTATATGATATTTATCCAAGATCAAATAGA
AATTATATTCAACCAAATAATATTAATAAAGAATTAGTAGTATATGGTTA
TAATTTAGAATCTTGTGTTGGTATACCTCTATATACTAATATTGTAAAAC
ATATAGTAGGTATTCCTAATAATATTTTATATATTATAACAGGTATTTTA
TTAACAGATGGTTGAATTGATTATCTATCTAAAAAAGATTTAGATAAAAA
AACAATTATAGAAATTAATTGTAGATTTAGATTAAAACAATCAATAATTC
ATAGTGAATATTTAATATATGTATTTATATTATTATCACATTATTGTATA
AGTTATCCTAAAATAAAAATTGCTAAAGTTAAAGGTAAATCATATAATCA
ATTAGAATTTTATACTAGATCATTACCATGTTTTACTATTTTAAGATATA
TATTTTATAATGGTAGAGTAAAAATTGTACCTAATAATTTATATGATTTA
TTAAATTATGAATCTTTAGCTCATATAATTATATGTGATGGTTCATTTGT
AAAAGGTGGAGGTTTATATTTAAATTTACAATCTTTTCTAACTAAAGAAT
TAATTTTTATTATAAATATTTTAAAAATTAAATTTAATTTAAATTGTCTA
TTACATAAATCTAGAAATAAATATCTTATTTATATAAGAGTAGAATCTGT
TAAAAGATTATTTCCTATAATTTATAAATATATTTTACCTTCTATAAGAT
ATAAATTTGATATTATATTATGACAAAAAAAATATAATATGATTAATTAA
Relationships

The following mRNA feature(s) are part of this gene:

Feature Name Unique Name Species Type
Q0070_mRNA Q0070_mRNA Saccharomyces cerevisiae mRNA


Alignments
The following features are aligned to this gene
Aligned Feature Feature Type Alignment Location
chrmt chromosome chrmt:13818..23167 +
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006316 movement of group I intron
cellular_component GO:0005739 mitochondrion
molecular_function GO:0004519 endonuclease activity
Resources