Q0060_mRNA (mRNA) Saccharomyces cerevisiae

Feature Details
Name Q0060_mRNA
Unique Name Q0060_mRNA
Internal ID 51986
Type mRNA
Organism Saccharomyces cerevisiae (yeast)
Annotated Sequence
Legend: exonpolypeptideintron
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>Q0060_mRNA chrmt:13818..19996 +
ATGGTACAAAGATGATTATATTCAACAAATGCAAAAGATATTGCAGTATT
ATATTTTATGTTAGCTATTTTTAGTGGTATGGCAGGAACAGCAATGTCTT
TAATCATTAGATTAGAATTAGCTGCACCTGGTTCACAATATTTACATGGT
AATTCACAATTATTTAATGGTGCGCCTCTCAGTGCGTATATTTCGTTGAT
GCGTCTAGCATTAGTATTATGAATCATCAATAGATACTTAAAACATATGA
CTAACTCAGTAGGGGCTAACTTTACGGGGACAATAGCATGTCATAAAACA
CCTATGATTAGTGTAGGTGGAGTTAAGTGTTACATGGTTAGGTTAACGAA
CTTCTTACAAGTCTTTATCAGGATTACAATTTCCTCTTATCATTTGGATA
TAGTAAAACAAGTTTGATTATTTTACGTTGAGGTAATCAGATTATGATTC
ATTGTTTTAGATAGCACAGGCAGTGTGAAAAAGATGAAGGACCTAAATAA
CACAAAAGGAAATACGAAAAGTGAGGGATCAACTGAAAGAGGAAACTCTG
GAGTTGACAGAGGTATAGTAGTACCGAATACTCAAATAAAAATGAGATTT
TTAAATCAAGTTAGATACTATTCAGTAAATAATAATTTAAAAATAGGGAA
GGATACCAATATTGAGTTATCAAAAGATACAAGTACTTCGGACTTGTTAG
AATTTGAGAAATTAGTAATAGATAATATAAATGAGGAAAATATAAATAAT
AATTTATTAAGTATTATAAAAAACGTAGATATATTAATATTAGCATATAA
TAGAATTAAGAGTAAACCTGGTAATATAACTCCAGGTACAACATTAGAAA
CATTAGATGGTATAAATATAATATATTTAAATAAATTATCAAATGAATTA
GGAACAGGTAAATTCAAATTTAAACCCATGAGAATAGTTAATATTCCTAA
ACCTAAAGGTGGTATAAGACCTTTAAGTGTAGGTAATCCAAGAGATAAAA
TTGTACAAGAAGTTATAAGAATAATTTTAGATACAATTTTTGATAAAAAG
ATATCAACACATTCACATGGTTTTAGAAAGAATATAAGTTGTCAAACAGC
AATTTGAGAAGTTAGAAATATATTTGGTGGAAGTAATTGATTTATTGAAG
TAGACTTAAAAAAATGTTTTGATACAATTTCTCATGATTTAATTATTAAA
GAATTAAAAAGATATATTTCAGATAAAGGTTTTATTGATTTAGTATATAA
ATTATTAAGAGCTGGTTATATTGATGAGAAAGGAACTTATCATAAACCTA
TATTAGGTTTACCTCAAGGATCATTAATTAGTCCTATCTTATGTAATATT
GTAATAACATTGGTAGATAATTGATTAGAAGATTATATTAATTTATATAA
TAAAGGTAAAGTTAAAAAACAACATCCTACATATAAAAAATTATCAAGAA
TAATTGCAAAAGCTAAAATATTTTCGACAAGATTAAAATTACATAAAGAA
AGAGCTAAAGGCCCACTATTTATTTATAATGATCCTAATTTCAAGAGAAT
AAAATACGTTAGATATGCAGATGATATTTTAATTGGGGTATTAGGTTCAA
AAAATGATTGTAAAATAATCAAAAGAGATTTAAACAATTTTTTAAATTCA
TTAGGTTTAACTATAAATGAAGAAAAAACTTTAATTACTTGTGCAACTGA
ACTACCAGCAAGATTTTTAGGTTATAATATTTCAATTACACCTTTAAAAA
GAATACCTACAGTTACTAAACTAATTAGAGGTAAACTTATTAGAAGTAGA
AATACAACTAGACCTATTATTAATGCACCAATTAGAGATATTATCAATAA
ATTAGCTACTAATGGATATTGTAAGCATAATAAAAATGGTAGAATAGGAG
TGCCTACAAGAGTAGGTAGATGACTATATGAAGAACCTAGAACAATTATT
AATAATTATAAAGCGTTAGGTAGAGGTATCTTAAATTATTATAAATTAGC
TACTAATTATAAAAGATTAAGAGAAAGAATCTATTACGTATTATATTATT
CATGTGTATTAACTTTAGCTAGTAAATATAGATTAAAAACAATAAGTAAA
ACTATTAAAAAATTTGGTTATAATTTAAATATTATTGAAAATGATAAATT
AATTGCCAATTTTCCAAGAAATACTTTTGATAATATCAAAAAAATTGAAA
ATCATGGTATATTTATATATATATCAGAAGCTAAAGTAACTGATCCTTTT
GAATATATCGATTCAATTAAATATATATTACCTACAGCTAAAGCTAATTT
TAATAAACCTTGTAGTATTTGTAATTCAACTATTGATGTAGAAATACATC
ATGTTAAACAATTACATAGAGGTATATTAAAAGCACTTAAAGATTATATT
CTAGGTAGAATAATTACCATAAACAGAAAACAAATTCCATTATGTAAACA
ATGTCATATTAAAACACATAAAAATAAATTTAAAAATATAGGACCTGGTA
TATAAAATCTATTATTAATGATACTCAATATGGAAAGCCGTATGATGGGA
AACTATCACGTACGGTTTGGGAAAGGCTCTTTAACACGTGGCAACATAGG
TTAATTTGCTATTTCATTTTTAGTAGTTGGTCATGCTGTATTAATGATTT
TCTGTGCGCCGTTTCGCTTAATTTATCACTGTATTGAAGTGTTAATTGAT
AAACATATCTCTGTTTATTCAATTAATGAAAACTTTACCGTATCATTTTG
GTTCTGATTATTAGTAGTAACATACATAGTATTTAGATACGTAAACCATA
TGGCTTACCCAGTTGGGGCCAACTCAACGGGGACAATAGCATGCCATAAA
AGCGCTGGAGTAAAACAGCCAGCGCAAGGTAAGAACTGTCCGATGGCTAG
GTTAACGAATTCCTGTAAAGAATGTTTAGGGTTCTCATTAACTCCTTCCC
ACTTGGGGATTGTGATTCATGCTTATGTATTGGAAGAAGAGGTACACGAG
TTAACCAAAAATGAATCATTAGCTTTAAGTAAAAGTTGACATTTGGAGGG
CTGTACGAGTTCAAATGGAAAATTAAGAAATACGGGATTGTCCGAAAGGG
GAAACCCTGGGGATAACGGAGTCTTCATAGTACCCAAATTTAATTTAAAT
AAAGTGAGATACTTTAGTACTTTATCTAAATTAAATGCAAGGAAGGAAGA
CAGTTTAGCGTATTTAACAAAGATTAATACTACGGATTTTTCCGAGTTAA
ATAAATTAATAGAAAATAATCATAATAAACTTGAAACCATTAATACTAGA
ATTTTAAAATTAATGTCAGATATTAGAATGTTATTAATTGCTTATAATAA
AATTAAAAGTAAGAAAGGTAATATATCTAAAGGTTCTAATAATATTACCT
TAGATGGGATTAATATTTCATATTTAAATAAATTATCTAAAGATATTAAC
ACTAATATGTTTAAATTTTCTCCGGTTAGAAGAGTTGAAATTCCTAAAAC
ATCTGGAGGATTTAGACCTTTAAGTGTTGGAAATCCTAGAGAAAAAATTG
TACAAGAAAGTATGAGAATAATATTAGAAATTATCTATAATAATAGTTTC
TCTTATTATTCTCATGGATTTAGACCTAACTTATCTTGTTTAACAGCTAT
TATTCAATGTAAAAATTATATGCAATACTGTAATTGATTTATTAAAGTAG
ATTTAAATAAATGCTTTGATACAATTCCACATAATATGTTAATTAATGTA
TTAAATGAGAGAATCAAAGATAAAGGTTTCATAGACTTATTATATAAATT
ATTAAGAGCTGGATATGTTGATAAAAATAATAATTATCATAATACAACTT
TAGGAATTCCTCAAGGTAGTGTTGTCAGTCCTATTTTATGTAATATTTTT
TTAGATAAATTAGATAAATATTTAGAAAATAAATTTGAGAATGAATTCAA
TACTGGAAATATGTCTAATAGAGGTAGAAATCCAATTTATAATAGTTTAT
CATCTAAAATTTATAGATGTAAATTATTATCTGAAAAATTAAAATTGATT
AGATTAAGAGACCATTACCAAAGAAATATGGGATCTGATAAAAGTTTTAA
AAGAGCTTATTTTGTTAGATATGCTGATGATATTATCATTGGTGTAATGG
GTTCTCATAATGATTGTAAAAATATTTTAAACGATATTAATAACTTCTTA
AAAGAAAATTTAGGTATGTCAATTAATATAGATAAATCCGTTATTAAACA
TTCTAAAGAAGGAGTTAGTTTTTTAGGGTATGATGTAAAAGTTACACCTT
GAGAAAAAAGACCTTATAGAATGATTAAAAAAGGTGATAATTTTATTAGG
GTTAGACATCATACTAGTTTAGTTGTTAATGCCCCTATTAGAAGTATTGT
AATAAAATTAAATAAACATGGCTATTGTTCTCATGGTATTTTAGGAAAAC
CCAGAGGGGTTGGAAGATTAATTCATGAAGAAATGAAAACCATTTTAATG
CATTACTTAGCTGTTGGTAGAGGTATTATAAACTATTATAGATTAGCTAC
CAATTTTACCACATTAAGAGGTAGAATTACATACATTTTATTTTATTCAT
GTTGTTTAACATTAGCAAGAAAATTTAAATTAAATACTGTTAAGAAAGTT
ATTTTAAAATTCGGTAAAGTATTAGTTGATCCTCATTCAAAAGTTAGTTT
TAGTATTGATGATTTTAAAATTAGACATAAAATAAATATAACTGATTCTA
ATTATACACCTGATGAAATTTTAGATAGATATAAATATATGTTACCTAGA
TCTTTATCATTATTTAGTGGTATTTGTCAAATTTGTGGTTCTAAACATGA
TTTAGAAGTACATCACGTAAGAACATTAAATAATGCTGCCAATAAAATTA
AAGATGATTATTTATTAGGTAGAATGATTAAGATAAATAGAAAACAAATT
ACTATCTGTAAAACATGTCATTTTAAAGTTCATCAAGGTAAATATAATGG
TCCAGGTTTATAATAATTATTATACTATTAAATATGCGTTAAATGGAGAG
CCGTATGATATGAAAGTATCACGTACGGTTCGGAGAGGGCTCTTTTATAT
GAATGTTATTACATTCAGATAGGTTTGCTACTCTACTCTTAGTAATGCCT
GCTTTAATTGGAGGTTTTGGTAACCAAAAAAGATATGAAAGTAATAATAA
TAATAATCAAGTAATAGAAAATAAAGAATATAATTTAAAATTAAATTATG
ATAAGTTGGGACCTTATTTAGCTGGATTAATTGAAGGTGATGGAACTATT
CTAGTTCAAAATTCATCTTCAATAAAAAAATCTAAATATAGACCGTTAAT
TGTTGTAGTATTTAAATTAGAAGATTTAGAATTAGCTAATTATTTATGTA
ATTTAACTAAATGTGGAAAAGTGTATAAAAAAATTAATCGTAATTATGTA
TTATGACTTATTCATGATTTAAAAGGTGTATATACATTATTAAATATTAT
TAATGGATATATGAGAACACCTAAATATGAAGCATTTGTTAGAGGTGCTG
AATTTATAAATAATTATATTAATTCAACAACAATTCTACATAATAAATTA
AAAAATATAGATAATATTAAAATTAAACCATTAGATACATCAGATATTGG
TTCAAACGCTTGATTAGCTGGTATGACAGATGCAGATGGTAATTTTTCTA
TTAATTTAATAAATGGTAAAAATCGTTCTAGTAGAGCAATGCCTTATTAT
TGTTTAGAATTAAGACAAAATTATCAAAAAAATTCTAATAATAATAATAT
TAATTTTTCTTATTTTTATATTATGTCTGCAATTGCACTATATTTTAATG
TTAATTTATATAGTAGAGAACGTAATTTAAATTTATTAGTATCTCTTAAT
AATACGTATAAACTATATTATAGTTATAAAGTAATAGTGGCTAATCTATA
TAAAAATATTAAAGTAATAGAATACTTTAATAAATATTCTTTATTATCAT
CTAAACACTTAGATTTTTTAGATTGATCTAAATTAGTTATTTTAATTAAT
AATGAGGGTCAAAGTATAAAACTTAATGGTAGTTGAGAATTAGGTATAAA
TTTACGTAAAGATTATAATAAAACTAGAACTACGTTTACTTGATCTCATT
TAAAAAATACATATTTAGAAAATAAATAA
Relationships

This mRNA is part of the following gene feature(s):

Feature Name Unique Name Species Type
Q0060 Q0060 Saccharomyces cerevisiae gene


The following polypeptide feature(s) are derives from this mRNA:

Feature Name Unique Name Species Type
polypeptide-auto59926 auto59926 Saccharomyces cerevisiae polypeptide
polypeptide-auto59919 auto59919 Saccharomyces cerevisiae polypeptide
polypeptide-auto59907 auto59907 Saccharomyces cerevisiae polypeptide
polypeptide-auto59888 auto59888 Saccharomyces cerevisiae polypeptide


The following exon feature(s) are part of this mRNA:

Feature Name Unique Name Species Type
Q0060_CDS auto59924 Saccharomyces cerevisiae exon
Q0060_CDS auto59922 Saccharomyces cerevisiae exon
Q0060_CDS auto59921 Saccharomyces cerevisiae exon
Q0060_CDS auto59915 Saccharomyces cerevisiae exon
Q0060_CDS auto59911 Saccharomyces cerevisiae exon
Q0060_CDS auto59909 Saccharomyces cerevisiae exon
Q0060_CDS auto59900 Saccharomyces cerevisiae exon
Q0060_CDS auto59894 Saccharomyces cerevisiae exon
Q0060_CDS auto59891 Saccharomyces cerevisiae exon
Q0060_CDS auto59876 Saccharomyces cerevisiae exon
Q0060_CDS auto59869 Saccharomyces cerevisiae exon
Q0060_CDS auto59865 Saccharomyces cerevisiae exon


The following intron feature(s) are part of this mRNA:

Feature Name Unique Name Species Type
Q0060_intron auto59310 Saccharomyces cerevisiae intron
Q0060_intron auto59309 Saccharomyces cerevisiae intron


Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
chrmt chromosome chrmt:13818..19996 +
Resources