Q0055 (gene) Saccharomyces cerevisiae

Feature Details
Name Q0055
Unique Name Q0055
Internal ID 44103
Type gene
Organism Saccharomyces cerevisiae (yeast)
Cross References
External references for this gene
Dababase Accession
SGD S000007262
Properties
Properties for the feature 'Q0055' include:
Property Name Value
Orf classification Verified
Display Reverse transcriptase required for splicing of the COX1 pre-mRNA
Gene AI2
Note Reverse transcriptase required for splicing of the COX1 pre-mRNA, encoded by a mobile group II intron within the mitochondrial COX1 gene
Annotated Terms
The following terms have been associated with this gene:

Biological Process

Term Definition
GO:0008380 RNA splicing

Cellular Component

Term Definition
GO:0005739 mitochondrion

Molecular Function

Term Definition
GO:0004519 endonuclease activity
GO:0003964 RNA-directed DNA polymerase activity
GO:0003723 RNA binding
GO:0003676 nucleic acid binding
Synonyms
The feature 'Q0055' has the following synonyms
Synonym
AI2
Annotated Sequence
Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>Q0055 chrmt:13818..18830 +
ATGGTACAAAGATGATTATATTCAACAAATGCAAAAGATATTGCAGTATT
ATATTTTATGTTAGCTATTTTTAGTGGTATGGCAGGAACAGCAATGTCTT
TAATCATTAGATTAGAATTAGCTGCACCTGGTTCACAATATTTACATGGT
AATTCACAATTATTTAATGGTGCGCCTCTCAGTGCGTATATTTCGTTGAT
GCGTCTAGCATTAGTATTATGAATCATCAATAGATACTTAAAACATATGA
CTAACTCAGTAGGGGCTAACTTTACGGGGACAATAGCATGTCATAAAACA
CCTATGATTAGTGTAGGTGGAGTTAAGTGTTACATGGTTAGGTTAACGAA
CTTCTTACAAGTCTTTATCAGGATTACAATTTCCTCTTATCATTTGGATA
TAGTAAAACAAGTTTGATTATTTTACGTTGAGGTAATCAGATTATGATTC
ATTGTTTTAGATAGCACAGGCAGTGTGAAAAAGATGAAGGACCTAAATAA
CACAAAAGGAAATACGAAAAGTGAGGGATCAACTGAAAGAGGAAACTCTG
GAGTTGACAGAGGTATAGTAGTACCGAATACTCAAATAAAAATGAGATTT
TTAAATCAAGTTAGATACTATTCAGTAAATAATAATTTAAAAATAGGGAA
GGATACCAATATTGAGTTATCAAAAGATACAAGTACTTCGGACTTGTTAG
AATTTGAGAAATTAGTAATAGATAATATAAATGAGGAAAATATAAATAAT
AATTTATTAAGTATTATAAAAAACGTAGATATATTAATATTAGCATATAA
TAGAATTAAGAGTAAACCTGGTAATATAACTCCAGGTACAACATTAGAAA
CATTAGATGGTATAAATATAATATATTTAAATAAATTATCAAATGAATTA
GGAACAGGTAAATTCAAATTTAAACCCATGAGAATAGTTAATATTCCTAA
ACCTAAAGGTGGTATAAGACCTTTAAGTGTAGGTAATCCAAGAGATAAAA
TTGTACAAGAAGTTATAAGAATAATTTTAGATACAATTTTTGATAAAAAG
ATATCAACACATTCACATGGTTTTAGAAAGAATATAAGTTGTCAAACAGC
AATTTGAGAAGTTAGAAATATATTTGGTGGAAGTAATTGATTTATTGAAG
TAGACTTAAAAAAATGTTTTGATACAATTTCTCATGATTTAATTATTAAA
GAATTAAAAAGATATATTTCAGATAAAGGTTTTATTGATTTAGTATATAA
ATTATTAAGAGCTGGTTATATTGATGAGAAAGGAACTTATCATAAACCTA
TATTAGGTTTACCTCAAGGATCATTAATTAGTCCTATCTTATGTAATATT
GTAATAACATTGGTAGATAATTGATTAGAAGATTATATTAATTTATATAA
TAAAGGTAAAGTTAAAAAACAACATCCTACATATAAAAAATTATCAAGAA
TAATTGCAAAAGCTAAAATATTTTCGACAAGATTAAAATTACATAAAGAA
AGAGCTAAAGGCCCACTATTTATTTATAATGATCCTAATTTCAAGAGAAT
AAAATACGTTAGATATGCAGATGATATTTTAATTGGGGTATTAGGTTCAA
AAAATGATTGTAAAATAATCAAAAGAGATTTAAACAATTTTTTAAATTCA
TTAGGTTTAACTATAAATGAAGAAAAAACTTTAATTACTTGTGCAACTGA
ACTACCAGCAAGATTTTTAGGTTATAATATTTCAATTACACCTTTAAAAA
GAATACCTACAGTTACTAAACTAATTAGAGGTAAACTTATTAGAAGTAGA
AATACAACTAGACCTATTATTAATGCACCAATTAGAGATATTATCAATAA
ATTAGCTACTAATGGATATTGTAAGCATAATAAAAATGGTAGAATAGGAG
TGCCTACAAGAGTAGGTAGATGACTATATGAAGAACCTAGAACAATTATT
AATAATTATAAAGCGTTAGGTAGAGGTATCTTAAATTATTATAAATTAGC
TACTAATTATAAAAGATTAAGAGAAAGAATCTATTACGTATTATATTATT
CATGTGTATTAACTTTAGCTAGTAAATATAGATTAAAAACAATAAGTAAA
ACTATTAAAAAATTTGGTTATAATTTAAATATTATTGAAAATGATAAATT
AATTGCCAATTTTCCAAGAAATACTTTTGATAATATCAAAAAAATTGAAA
ATCATGGTATATTTATATATATATCAGAAGCTAAAGTAACTGATCCTTTT
GAATATATCGATTCAATTAAATATATATTACCTACAGCTAAAGCTAATTT
TAATAAACCTTGTAGTATTTGTAATTCAACTATTGATGTAGAAATACATC
ATGTTAAACAATTACATAGAGGTATATTAAAAGCACTTAAAGATTATATT
CTAGGTAGAATAATTACCATAAACAGAAAACAAATTCCATTATGTAAACA
ATGTCATATTAAAACACATAAAAATAAATTTAAAAATATAGGACCTGGTA
TATAAAATCTATTATTAATGATACTCAATATGGAAAGCCGTATGATGGGA
AACTATCACGTACGGTTTGGGAAAGGCTCTTTAACACGTGGCAACATAGG
TTAATTTGCTATTTCATTTTTAGTAGTTGGTCATGCTGTATTAATGATTT
TCTGTGCGCCGTTTCGCTTAATTTATCACTGTATTGAAGTGTTAATTGAT
AAACATATCTCTGTTTATTCAATTAATGAAAACTTTACCGTATCATTTTG
GTTCTGATTATTAGTAGTAACATACATAGTATTTAGATACGTAAACCATA
TGGCTTACCCAGTTGGGGCCAACTCAACGGGGACAATAGCATGCCATAAA
AGCGCTGGAGTAAAACAGCCAGCGCAAGGTAAGAACTGTCCGATGGCTAG
GTTAACGAATTCCTGTAAAGAATGTTTAGGGTTCTCATTAACTCCTTCCC
ACTTGGGGATTGTGATTCATGCTTATGTATTGGAAGAAGAGGTACACGAG
TTAACCAAAAATGAATCATTAGCTTTAAGTAAAAGTTGACATTTGGAGGG
CTGTACGAGTTCAAATGGAAAATTAAGAAATACGGGATTGTCCGAAAGGG
GAAACCCTGGGGATAACGGAGTCTTCATAGTACCCAAATTTAATTTAAAT
AAAGTGAGATACTTTAGTACTTTATCTAAATTAAATGCAAGGAAGGAAGA
CAGTTTAGCGTATTTAACAAAGATTAATACTACGGATTTTTCCGAGTTAA
ATAAATTAATAGAAAATAATCATAATAAACTTGAAACCATTAATACTAGA
ATTTTAAAATTAATGTCAGATATTAGAATGTTATTAATTGCTTATAATAA
AATTAAAAGTAAGAAAGGTAATATATCTAAAGGTTCTAATAATATTACCT
TAGATGGGATTAATATTTCATATTTAAATAAATTATCTAAAGATATTAAC
ACTAATATGTTTAAATTTTCTCCGGTTAGAAGAGTTGAAATTCCTAAAAC
ATCTGGAGGATTTAGACCTTTAAGTGTTGGAAATCCTAGAGAAAAAATTG
TACAAGAAAGTATGAGAATAATATTAGAAATTATCTATAATAATAGTTTC
TCTTATTATTCTCATGGATTTAGACCTAACTTATCTTGTTTAACAGCTAT
TATTCAATGTAAAAATTATATGCAATACTGTAATTGATTTATTAAAGTAG
ATTTAAATAAATGCTTTGATACAATTCCACATAATATGTTAATTAATGTA
TTAAATGAGAGAATCAAAGATAAAGGTTTCATAGACTTATTATATAAATT
ATTAAGAGCTGGATATGTTGATAAAAATAATAATTATCATAATACAACTT
TAGGAATTCCTCAAGGTAGTGTTGTCAGTCCTATTTTATGTAATATTTTT
TTAGATAAATTAGATAAATATTTAGAAAATAAATTTGAGAATGAATTCAA
TACTGGAAATATGTCTAATAGAGGTAGAAATCCAATTTATAATAGTTTAT
CATCTAAAATTTATAGATGTAAATTATTATCTGAAAAATTAAAATTGATT
AGATTAAGAGACCATTACCAAAGAAATATGGGATCTGATAAAAGTTTTAA
AAGAGCTTATTTTGTTAGATATGCTGATGATATTATCATTGGTGTAATGG
GTTCTCATAATGATTGTAAAAATATTTTAAACGATATTAATAACTTCTTA
AAAGAAAATTTAGGTATGTCAATTAATATAGATAAATCCGTTATTAAACA
TTCTAAAGAAGGAGTTAGTTTTTTAGGGTATGATGTAAAAGTTACACCTT
GAGAAAAAAGACCTTATAGAATGATTAAAAAAGGTGATAATTTTATTAGG
GTTAGACATCATACTAGTTTAGTTGTTAATGCCCCTATTAGAAGTATTGT
AATAAAATTAAATAAACATGGCTATTGTTCTCATGGTATTTTAGGAAAAC
CCAGAGGGGTTGGAAGATTAATTCATGAAGAAATGAAAACCATTTTAATG
CATTACTTAGCTGTTGGTAGAGGTATTATAAACTATTATAGATTAGCTAC
CAATTTTACCACATTAAGAGGTAGAATTACATACATTTTATTTTATTCAT
GTTGTTTAACATTAGCAAGAAAATTTAAATTAAATACTGTTAAGAAAGTT
ATTTTAAAATTCGGTAAAGTATTAGTTGATCCTCATTCAAAAGTTAGTTT
TAGTATTGATGATTTTAAAATTAGACATAAAATAAATATAACTGATTCTA
ATTATACACCTGATGAAATTTTAGATAGATATAAATATATGTTACCTAGA
TCTTTATCATTATTTAGTGGTATTTGTCAAATTTGTGGTTCTAAACATGA
TTTAGAAGTACATCACGTAAGAACATTAAATAATGCTGCCAATAAAATTA
AAGATGATTATTTATTAGGTAGAATGATTAAGATAAATAGAAAACAAATT
ACTATCTGTAAAACATGTCATTTTAAAGTTCATCAAGGTAAATATAATGG
TCCAGGTTTATAA
Relationships

The following mRNA feature(s) are part of this gene:

Feature Name Unique Name Species Type
Q0055_mRNA Q0055_mRNA Saccharomyces cerevisiae mRNA


Alignments
The following features are aligned to this gene
Aligned Feature Feature Type Alignment Location
chrmt chromosome chrmt:13818..18830 +
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008380 RNA splicing
cellular_component GO:0005739 mitochondrion
molecular_function GO:0004519 endonuclease activity
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0003723 RNA binding
molecular_function GO:0003964 RNA-directed DNA polymerase activity
Resources