Q0045_mRNA (mRNA) Saccharomyces cerevisiae

Feature Details
Name Q0045_mRNA
Unique Name Q0045_mRNA
Internal ID 51983
Type mRNA
Organism Saccharomyces cerevisiae (yeast)
Annotated Sequence
Legend: exonpolypeptideintron
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>Q0045_mRNA chrmt:13818..26701 +
ATGGTACAAAGATGATTATATTCAACAAATGCAAAAGATATTGCAGTATT
ATATTTTATGTTAGCTATTTTTAGTGGTATGGCAGGAACAGCAATGTCTT
TAATCATTAGATTAGAATTAGCTGCACCTGGTTCACAATATTTACATGGT
AATTCACAATTATTTAATGGTGCGCCTCTCAGTGCGTATATTTCGTTGAT
GCGTCTAGCATTAGTATTATGAATCATCAATAGATACTTAAAACATATGA
CTAACTCAGTAGGGGCTAACTTTACGGGGACAATAGCATGTCATAAAACA
CCTATGATTAGTGTAGGTGGAGTTAAGTGTTACATGGTTAGGTTAACGAA
CTTCTTACAAGTCTTTATCAGGATTACAATTTCCTCTTATCATTTGGATA
TAGTAAAACAAGTTTGATTATTTTACGTTGAGGTAATCAGATTATGATTC
ATTGTTTTAGATAGCACAGGCAGTGTGAAAAAGATGAAGGACCTAAATAA
CACAAAAGGAAATACGAAAAGTGAGGGATCAACTGAAAGAGGAAACTCTG
GAGTTGACAGAGGTATAGTAGTACCGAATACTCAAATAAAAATGAGATTT
TTAAATCAAGTTAGATACTATTCAGTAAATAATAATTTAAAAATAGGGAA
GGATACCAATATTGAGTTATCAAAAGATACAAGTACTTCGGACTTGTTAG
AATTTGAGAAATTAGTAATAGATAATATAAATGAGGAAAATATAAATAAT
AATTTATTAAGTATTATAAAAAACGTAGATATATTAATATTAGCATATAA
TAGAATTAAGAGTAAACCTGGTAATATAACTCCAGGTACAACATTAGAAA
CATTAGATGGTATAAATATAATATATTTAAATAAATTATCAAATGAATTA
GGAACAGGTAAATTCAAATTTAAACCCATGAGAATAGTTAATATTCCTAA
ACCTAAAGGTGGTATAAGACCTTTAAGTGTAGGTAATCCAAGAGATAAAA
TTGTACAAGAAGTTATAAGAATAATTTTAGATACAATTTTTGATAAAAAG
ATATCAACACATTCACATGGTTTTAGAAAGAATATAAGTTGTCAAACAGC
AATTTGAGAAGTTAGAAATATATTTGGTGGAAGTAATTGATTTATTGAAG
TAGACTTAAAAAAATGTTTTGATACAATTTCTCATGATTTAATTATTAAA
GAATTAAAAAGATATATTTCAGATAAAGGTTTTATTGATTTAGTATATAA
ATTATTAAGAGCTGGTTATATTGATGAGAAAGGAACTTATCATAAACCTA
TATTAGGTTTACCTCAAGGATCATTAATTAGTCCTATCTTATGTAATATT
GTAATAACATTGGTAGATAATTGATTAGAAGATTATATTAATTTATATAA
TAAAGGTAAAGTTAAAAAACAACATCCTACATATAAAAAATTATCAAGAA
TAATTGCAAAAGCTAAAATATTTTCGACAAGATTAAAATTACATAAAGAA
AGAGCTAAAGGCCCACTATTTATTTATAATGATCCTAATTTCAAGAGAAT
AAAATACGTTAGATATGCAGATGATATTTTAATTGGGGTATTAGGTTCAA
AAAATGATTGTAAAATAATCAAAAGAGATTTAAACAATTTTTTAAATTCA
TTAGGTTTAACTATAAATGAAGAAAAAACTTTAATTACTTGTGCAACTGA
ACTACCAGCAAGATTTTTAGGTTATAATATTTCAATTACACCTTTAAAAA
GAATACCTACAGTTACTAAACTAATTAGAGGTAAACTTATTAGAAGTAGA
AATACAACTAGACCTATTATTAATGCACCAATTAGAGATATTATCAATAA
ATTAGCTACTAATGGATATTGTAAGCATAATAAAAATGGTAGAATAGGAG
TGCCTACAAGAGTAGGTAGATGACTATATGAAGAACCTAGAACAATTATT
AATAATTATAAAGCGTTAGGTAGAGGTATCTTAAATTATTATAAATTAGC
TACTAATTATAAAAGATTAAGAGAAAGAATCTATTACGTATTATATTATT
CATGTGTATTAACTTTAGCTAGTAAATATAGATTAAAAACAATAAGTAAA
ACTATTAAAAAATTTGGTTATAATTTAAATATTATTGAAAATGATAAATT
AATTGCCAATTTTCCAAGAAATACTTTTGATAATATCAAAAAAATTGAAA
ATCATGGTATATTTATATATATATCAGAAGCTAAAGTAACTGATCCTTTT
GAATATATCGATTCAATTAAATATATATTACCTACAGCTAAAGCTAATTT
TAATAAACCTTGTAGTATTTGTAATTCAACTATTGATGTAGAAATACATC
ATGTTAAACAATTACATAGAGGTATATTAAAAGCACTTAAAGATTATATT
CTAGGTAGAATAATTACCATAAACAGAAAACAAATTCCATTATGTAAACA
ATGTCATATTAAAACACATAAAAATAAATTTAAAAATATAGGACCTGGTA
TATAAAATCTATTATTAATGATACTCAATATGGAAAGCCGTATGATGGGA
AACTATCACGTACGGTTTGGGAAAGGCTCTTTAACACGTGGCAACATAGG
TTAATTTGCTATTTCATTTTTAGTAGTTGGTCATGCTGTATTAATGATTT
TCTGTGCGCCGTTTCGCTTAATTTATCACTGTATTGAAGTGTTAATTGAT
AAACATATCTCTGTTTATTCAATTAATGAAAACTTTACCGTATCATTTTG
GTTCTGATTATTAGTAGTAACATACATAGTATTTAGATACGTAAACCATA
TGGCTTACCCAGTTGGGGCCAACTCAACGGGGACAATAGCATGCCATAAA
AGCGCTGGAGTAAAACAGCCAGCGCAAGGTAAGAACTGTCCGATGGCTAG
GTTAACGAATTCCTGTAAAGAATGTTTAGGGTTCTCATTAACTCCTTCCC
ACTTGGGGATTGTGATTCATGCTTATGTATTGGAAGAAGAGGTACACGAG
TTAACCAAAAATGAATCATTAGCTTTAAGTAAAAGTTGACATTTGGAGGG
CTGTACGAGTTCAAATGGAAAATTAAGAAATACGGGATTGTCCGAAAGGG
GAAACCCTGGGGATAACGGAGTCTTCATAGTACCCAAATTTAATTTAAAT
AAAGTGAGATACTTTAGTACTTTATCTAAATTAAATGCAAGGAAGGAAGA
CAGTTTAGCGTATTTAACAAAGATTAATACTACGGATTTTTCCGAGTTAA
ATAAATTAATAGAAAATAATCATAATAAACTTGAAACCATTAATACTAGA
ATTTTAAAATTAATGTCAGATATTAGAATGTTATTAATTGCTTATAATAA
AATTAAAAGTAAGAAAGGTAATATATCTAAAGGTTCTAATAATATTACCT
TAGATGGGATTAATATTTCATATTTAAATAAATTATCTAAAGATATTAAC
ACTAATATGTTTAAATTTTCTCCGGTTAGAAGAGTTGAAATTCCTAAAAC
ATCTGGAGGATTTAGACCTTTAAGTGTTGGAAATCCTAGAGAAAAAATTG
TACAAGAAAGTATGAGAATAATATTAGAAATTATCTATAATAATAGTTTC
TCTTATTATTCTCATGGATTTAGACCTAACTTATCTTGTTTAACAGCTAT
TATTCAATGTAAAAATTATATGCAATACTGTAATTGATTTATTAAAGTAG
ATTTAAATAAATGCTTTGATACAATTCCACATAATATGTTAATTAATGTA
TTAAATGAGAGAATCAAAGATAAAGGTTTCATAGACTTATTATATAAATT
ATTAAGAGCTGGATATGTTGATAAAAATAATAATTATCATAATACAACTT
TAGGAATTCCTCAAGGTAGTGTTGTCAGTCCTATTTTATGTAATATTTTT
TTAGATAAATTAGATAAATATTTAGAAAATAAATTTGAGAATGAATTCAA
TACTGGAAATATGTCTAATAGAGGTAGAAATCCAATTTATAATAGTTTAT
CATCTAAAATTTATAGATGTAAATTATTATCTGAAAAATTAAAATTGATT
AGATTAAGAGACCATTACCAAAGAAATATGGGATCTGATAAAAGTTTTAA
AAGAGCTTATTTTGTTAGATATGCTGATGATATTATCATTGGTGTAATGG
GTTCTCATAATGATTGTAAAAATATTTTAAACGATATTAATAACTTCTTA
AAAGAAAATTTAGGTATGTCAATTAATATAGATAAATCCGTTATTAAACA
TTCTAAAGAAGGAGTTAGTTTTTTAGGGTATGATGTAAAAGTTACACCTT
GAGAAAAAAGACCTTATAGAATGATTAAAAAAGGTGATAATTTTATTAGG
GTTAGACATCATACTAGTTTAGTTGTTAATGCCCCTATTAGAAGTATTGT
AATAAAATTAAATAAACATGGCTATTGTTCTCATGGTATTTTAGGAAAAC
CCAGAGGGGTTGGAAGATTAATTCATGAAGAAATGAAAACCATTTTAATG
CATTACTTAGCTGTTGGTAGAGGTATTATAAACTATTATAGATTAGCTAC
CAATTTTACCACATTAAGAGGTAGAATTACATACATTTTATTTTATTCAT
GTTGTTTAACATTAGCAAGAAAATTTAAATTAAATACTGTTAAGAAAGTT
ATTTTAAAATTCGGTAAAGTATTAGTTGATCCTCATTCAAAAGTTAGTTT
TAGTATTGATGATTTTAAAATTAGACATAAAATAAATATAACTGATTCTA
ATTATACACCTGATGAAATTTTAGATAGATATAAATATATGTTACCTAGA
TCTTTATCATTATTTAGTGGTATTTGTCAAATTTGTGGTTCTAAACATGA
TTTAGAAGTACATCACGTAAGAACATTAAATAATGCTGCCAATAAAATTA
AAGATGATTATTTATTAGGTAGAATGATTAAGATAAATAGAAAACAAATT
ACTATCTGTAAAACATGTCATTTTAAAGTTCATCAAGGTAAATATAATGG
TCCAGGTTTATAATAATTATTATACTATTAAATATGCGTTAAATGGAGAG
CCGTATGATATGAAAGTATCACGTACGGTTCGGAGAGGGCTCTTTTATAT
GAATGTTATTACATTCAGATAGGTTTGCTACTCTACTCTTAGTAATGCCT
GCTTTAATTGGAGGTTTTGGTAACCAAAAAAGATATGAAAGTAATAATAA
TAATAATCAAGTAATAGAAAATAAAGAATATAATTTAAAATTAAATTATG
ATAAGTTGGGACCTTATTTAGCTGGATTAATTGAAGGTGATGGAACTATT
CTAGTTCAAAATTCATCTTCAATAAAAAAATCTAAATATAGACCGTTAAT
TGTTGTAGTATTTAAATTAGAAGATTTAGAATTAGCTAATTATTTATGTA
ATTTAACTAAATGTGGAAAAGTGTATAAAAAAATTAATCGTAATTATGTA
TTATGACTTATTCATGATTTAAAAGGTGTATATACATTATTAAATATTAT
TAATGGATATATGAGAACACCTAAATATGAAGCATTTGTTAGAGGTGCTG
AATTTATAAATAATTATATTAATTCAACAACAATTCTACATAATAAATTA
AAAAATATAGATAATATTAAAATTAAACCATTAGATACATCAGATATTGG
TTCAAACGCTTGATTAGCTGGTATGACAGATGCAGATGGTAATTTTTCTA
TTAATTTAATAAATGGTAAAAATCGTTCTAGTAGAGCAATGCCTTATTAT
TGTTTAGAATTAAGACAAAATTATCAAAAAAATTCTAATAATAATAATAT
TAATTTTTCTTATTTTTATATTATGTCTGCAATTGCACTATATTTTAATG
TTAATTTATATAGTAGAGAACGTAATTTAAATTTATTAGTATCTCTTAAT
AATACGTATAAACTATATTATAGTTATAAAGTAATAGTGGCTAATCTATA
TAAAAATATTAAAGTAATAGAATACTTTAATAAATATTCTTTATTATCAT
CTAAACACTTAGATTTTTTAGATTGATCTAAATTAGTTATTTTAATTAAT
AATGAGGGTCAAAGTATAAAACTTAATGGTAGTTGAGAATTAGGTATAAA
TTTACGTAAAGATTATAATAAAACTAGAACTACGTTTACTTGATCTCATT
TAAAAAATACATATTTAGAAAATAAATAAATAAATTATTATTACTTTCTT
CCCCTCCGAATCCGTAATATATTTACGGATATATAATCTCGTAGTGTAAA
AGGTGTAACGAGATTATTAATAAGTTGCCGTAATATATTGTAAAATATAT
TATTATTACAACACTATATGCGGGAAAACCCTAAAGTCATAATATAATAT
TATCCCCACGAGGGCCACACATGTGTGGCCCTCGCGGGGTATGGTAAATT
TAATTAAGTTATAAATGTACTATAGTATTAAAAATTATTATGAATAATTT
CCCCACCCCCATGCGAAGCATGGGGGGGGGTATAAGTATGGACAATCCGC
AGGAAACCAAATAATAATTAATATCCTGAAACAAAGTAAGTGAAGGAGAT
ATCTTAAAATATATATAATATATATTTTATAAATTATTATGTAGGATCCT
CAGAGACTACACGTGTTGCACCCATTATATTATGTATAATGGGTTGAAGA
TATAGTCCAAATATAATTGAAAGATTATAATAAAATGAACTATTTATTAC
CATTAATAATTGGAGCTACAGATACAGCATTTCCAAGAATTAATAACATT
GCTTTTTGAGTATTACCTATGGGGTTAGTATGTTTAGTTACATCAACTTT
AGTAGAATCAGGTGCTGGTACAGGGTGAACTGTCTATCCACCATTATCAT
CTATTCAGGCACATTCAGGACCTAGTGTAGATTTAGCAATTTTTGCATTA
CATTTAACATCAATTTCATCATTATTAGGTGCTATTAATTTCATTGTAAC
AACATTAAATATGAGAACAAATGGTATGACAATGCATAAATTACCATTAT
TTGTATGATCAATTTTCATTACAGCGTTCTTATTATTATTATCATTACCT
GTATTATCTGCTGGTATTACAATGTTATTATTAGATAGAAACTTCAATAC
TTCATTCTTTGAAGTATCAGGAGGTGGTGACCCAATCTTATACGAGCATT
TATTTTGATTCTTTGGTCAAACAGTGGCCCTTATTATTATATTAATAATA
TATAATGATATGCATTTTTCTAAATGCTGGAAATTATTAAAAAAATGAAT
TACAAATATTATAAGTCTATTATTTAAAGCCTTATTTGTAAAAATATTCA
TATCTTATAATAATCAGCAGGATAAGATAATAAATAATCTTATATTAAAA
AAAGATAATATTAAAAGATCCTCAGAGACTACAAGAAAAATATTAAATAA
TTCAATAAATAAAAAATTTAATCAATGATTAGCTGGATTAATTGATGGTG
ATGGATATTTTGGTATTGTAAGTAAGAAATATGTATCATTAGAAATTCTA
GTAGCATTAGAAGATGAAATAGCTTTAAAAGAAATTCAAAATAAATTTGG
TGGTTCTATTAAATTAAGATCAGGTGTAAAAGCTATTAGATATAGATTAC
TTAATAAAACTGGTATAATTAAATTAATTAATGCAGTTAATGGTAATATT
AGAAATACTAAAAGATTAGTACAATTTAATAAAGTTTGTATTTTATTAGG
TATTGATTTTATTTATCCAATTAAATTAACTAAAGATAATAGTTGATTTG
TTGGATTTTTTGATGCTGATGGTACAATTAATTATTCATTTAAAAATAAT
CATCCTCAATTAACAATTTCTGTAACTAATAAATATTTACAAGATGTACA
AGAATATAAAAATATTTTAGGTGGTAATATTTATTTTGATAAATCACAAA
ATGGTTATTATAAATGATCCATTCAATCAAAAGATATAGTATTAAATTTT
ATTAATGATTATATTAAAATAAATCCATCAAGAACACTAAAAATAAATAA
ATTATATTTAAGTAAAGAATTTTATAATTTAAAAGAATTAAAAGCTTATA
ATAAATCTTCTGATTCAATACAATATAAAGCATGATTAAATTTTGAAAAT
AAATGAAAAAATAAATAAATTATTTAATAAAGATATAGTCCAAATTATAT
ATATATAATATATATATATATAACAAGCACCCTGAAGTATATATTTTAAT
TATTCCTGGATTTGGTATTATTTCACATGTAGTATCAACATATTCTAAAA
AACCTGTATTTGGTGAAATTTCAATGGTATATGCTATGGCTTCAATTGGA
TTATTAGGATTCTTAGTATGATCACATCATATGTATATTGTAGGATTAGA
TGCAGATCTTAGAGCATATTTCCTATCTGCACTAATGATTATTGCAATTC
CAACAGGAATTAAAATTTTCTCATGATTAATAAATCCCTTTAGCAAGGAT
AAAAATAAAAATAAAAATAAAAAGTTGATCAGAAATTATCAAAAAATAAA
TAATAATAATATAATAAAAACATATTTAAATAATAATAATATAATTATAA
TAAATATATATAAAGGTAATTTATATGATATTTATCCAAGATCAAATAGA
AATTATATTCAACCAAATAATATTAATAAAGAATTAGTAGTATATGGTTA
TAATTTAGAATCTTGTGTTGGTATACCTCTATATACTAATATTGTAAAAC
ATATAGTAGGTATTCCTAATAATATTTTATATATTATAACAGGTATTTTA
TTAACAGATGGTTGAATTGATTATCTATCTAAAAAAGATTTAGATAAAAA
AACAATTATAGAAATTAATTGTAGATTTAGATTAAAACAATCAATAATTC
ATAGTGAATATTTAATATATGTATTTATATTATTATCACATTATTGTATA
AGTTATCCTAAAATAAAAATTGCTAAAGTTAAAGGTAAATCATATAATCA
ATTAGAATTTTATACTAGATCATTACCATGTTTTACTATTTTAAGATATA
TATTTTATAATGGTAGAGTAAAAATTGTACCTAATAATTTATATGATTTA
TTAAATTATGAATCTTTAGCTCATATAATTATATGTGATGGTTCATTTGT
AAAAGGTGGAGGTTTATATTTAAATTTACAATCTTTTCTAACTAAAGAAT
TAATTTTTATTATAAATATTTTAAAAATTAAATTTAATTTAAATTGTCTA
TTACATAAATCTAGAAATAAATATCTTATTTATATAAGAGTAGAATCTGT
TAAAAGATTATTTCCTATAATTTATAAATATATTTTACCTTCTATAAGAT
ATAAATTTGATATTATATTATGACAAAAAAAATATAATATGATTAATTAA
TTAATTAATTAATTAATTTATTTATTATTTACTTTTTTGATATATATAGA
GGCAAACTCGAGGAAAACCATATAATTAGAATAAGTAATAATTATATGAC
AACCGTCGAACTAAATCATATTCAAGAAATTAATATGTAAAAGCGTAGAG
ATTAGACGCCTCTGGTTATCTAAGTAATATATATATATATATTATATGAT
AACATAAGGTATAATCCAATGAGATCAGTAATGATTTTAAAACAATAATT
TTGTTTTAAGTATTAATAATAATATTAATATTCGACCTCTTAATTGAGGA
TATTATAATCATAATTTTTTATATTATAATATAAAATTTAACTAGCTAGA
TAATATTATATAAAAAAAAAAAATAATATTATATAAATTAATTAAAATAA
TTTTTATTAATTGAAACTGAAATGTTTTAAAGTTAAATAAAAGAGCTCTA
ATCCATGGTGGTTCAATTAGATTAGCACTACCTATGTTATATGCAATTGC
ATTCTTATTCTTATTCACAATGGGTGGTTTAACTGGTGTTGCCTTAGCTA
ACGCCTCATTAGATGTAGCATTCCACGATATTAATTTAATAAGTGTCGTG
CTTAAAATTCACTAAAATAATATATAATAAATTATAATAAATATATAAAA
AAAATAAAAAAAATAAAAAAAAATTAATATCTTATGATTAATTTTATATA
AATAAAAATTTATTAAATATTATTGGTTATATATATATATATATTAATAA
TAAAAAAATATATATATATATATAGCTAACGGGGAAACTCTTATAATTAT
TATTTATATAATAAATAAGACAATCCCGTGATAACTTTAATATATATATA
TTATATATTAAAGTATTGTAGAGACTAAACGTGAATGATTTTAATATTAT
TTAAATATTAAAATTAAGAGATAGTCCAATCTTATATGTAAATATAAGTT
AATACCAAAAAAAAAATAATATTATTTTGACTTATTATATATTAATATTA
TTAATAATAATTTTAACTAATAATAAAGTTTTTATAGAAACTTTATATTA
TTATTTAATATTTAATTTTCAATTAATATCTCCTTTTGGGGTTCCGGTCC
CTGGTCCGGCCCCCGAAACTAAAGATATTAAGAATTTATATGAATCAATT
ATAAATAATTATATTAATATTTTAAATAAATATCTTATTAATATTAATAA
AGATAATATTAATAAATTAAAATTTTTAGATAATTATACTGAAGAAGAAA
AAGGTTATTATTTATCTGGATTATTTGAAGGAGATGGTAATATTTATACT
AGATGTTTTTCAATTACTTTTTCTTTAGAAGATGTTTTATTAGCTAATTA
TTTATGTCTTTATTTTAAAATTGGTCATATTACAGCTAAATATAATTTTA
ATAAAGAATTAACAGCTGTTAAATGAAATATTATAAAAAAAAAAGAACAA
GAAGTATTTATAAATTATATTAATGGTAAATTATTAACATATAAAAGATA
TGATCAATATTTTAAATATAATTTTAATAATCGTTTAAATATTAAATTAT
TAAAACCTAAAGAATTTGATTTACTATTAAATCCTTGATTAACAGGTTTT
AATGATGCTGATGGTTATTTTTATCTAGGTTTTCAAAAACATAAAAATAG
TCAATGATTAAAATTTCATTTAGAATTATCACAAAAAGATAGTTATATTT
TAGTCCGGCCCGCCCCCGCGGGGCGGACCCCAAAGGAGATATTATTAAAA
AATATTTTAAACTTGGTGGTATTTTAAAAAGAGATTATAAATCTGGTGCT
ACAGCTTATATTTATAAAGCTCAATCATCAAAAGCTATAAAACCTTTTAT
TGAATATTTTAATAATTATCAACCATTAAGTCTTAGAAGATATAAACAAT
ATTTATTATTAAATATTGCTTACTTATTAAAATTAAATAAATTACATATA
TTACTTAATTCTTTATTAATATTAAAAGAATTAATATTATTACAAAGTGT
TAAAAATATATCTTTAGAAATAAAAAATGAATTAAATAATAGAGTTAAAA
TTATTATTAATAAACTTCATTATAACAATATCGAATAATGATAATATTAA
AGAGTAAAATTCTTAAAGTGTTAATTAAATAATATTCTTTTTTTTTTATG
ACTTACTACGTGGTGGGACATTTTCGTGCGGTCTGAAAGTTATCATAAAT
AATATTTACCATATAATAATGGATAAATTATATTTTTATCAATATAAGTC
TAATTACAAGTGTATTAAAATGGTAACATAAATATGCTAAGCTGTAATGA
CAAAAGTATCCATATTCTTGACAGTTATATTATAAAAAAAGATGAAGGAA
CTTTGACTGATCTAATATGCTCAACGAAAGTGAATCAAATGTTATAAAAT
TACTTACACCACTAATTGAAAACCTGTCTGATATTCAATTATTATTTATT
ATTATATAATTATATAATAATAAATAAAATGGTTGATGTTATGTATTGGA
AATGAGCATACGATAAATCATATAACCATTAGTAATATAATTTGAGAGCT
AAGTTAGATATTTACGTATTTATGATAAAACAGAATAAACCCTATAAATT
ATTATTATTAATAATAAAAAATAATAATAATACCAATATATATATTATTT
AATTTATTATTATTATATTAATAAAATTTAATATATATTATAAATAATTA
TTGGATTAAGAAATATAATATTTTATAGAAATTTTCTTTATATTTAGAGG
GTAAAAGATTGTATAAAAAGCTAATGCCATATTGTAATGATATGGATAAG
AATTATTATTCTAAAGATGAAAATCTGCTAACTTATACTATAGGTGATAT
GCCTATCTTTATTTATATATATATTATTATTATTAATAATAAAAAAAAAA
ATTAAAAAAAAGATAGGAGGTTTATATATAACTGATAAATATTTATTATA
TTATTTTTTTTTATAATAAATATTAAAAGATATTGCGTGAGCCGTATGCG
ATGAAAGTCGCACGTACGGTTCTTACCGGGGGAAAACTTGTAAAGGTCTA
CCTATCGGGATACTATGTATTATCAATGGGTGCTATTTTCTCTTTATTTG
CAGGATACTATTATTGAAGTCCTCAAATTTTAGGTTTAAACTATAATGAA
AAATTAGCTCAAATTCAATTCTGATTAATTTTCATTGGGGCTAATGTTAT
TTTCTTCCCAATGCATTTTTTAGGTATTAATGGTATGCCTAGAAGAATTC
CTGATTATCCTGATGCTTTCGCAGGATGAAATTATGTCGCTTCTATTGGT
TCATTCATTGCACTATTATCATTATTCTTATTTATCTATATTTTATATGA
TCAATTAGTTAATGGATTAAACAATAAAGTTAATAATAAATCAGTTATTT
ATAATAAAGCACCTGATTTTGTAGAATCTAATCTTATCTTTAATTTAAAT
ACAGTTAAATCTTCATCTATCGAATTCTTATTAACTTCTCCACCAGCTGT
ACACTCATTTAATACACCAGCTGTACAATCTTAA
Relationships

This mRNA is part of the following gene feature(s):

Feature Name Unique Name Species Type
Q0045 Q0045 Saccharomyces cerevisiae gene


The following polypeptide feature(s) are derives from this mRNA:

Feature Name Unique Name Species Type
polypeptide-auto59889 auto59889 Saccharomyces cerevisiae polypeptide


The following exon feature(s) are part of this mRNA:

Feature Name Unique Name Species Type
Q0045_CDS auto59884 Saccharomyces cerevisiae exon
Q0045_CDS auto59883 Saccharomyces cerevisiae exon
Q0045_CDS auto59882 Saccharomyces cerevisiae exon
Q0045_CDS auto59880 Saccharomyces cerevisiae exon
Q0045_CDS auto59877 Saccharomyces cerevisiae exon
Q0045_CDS auto59873 Saccharomyces cerevisiae exon
Q0045_CDS auto59868 Saccharomyces cerevisiae exon
Q0045_CDS auto59863 Saccharomyces cerevisiae exon


The following intron feature(s) are part of this mRNA:

Feature Name Unique Name Species Type
Q0045_intron auto59307 Saccharomyces cerevisiae intron
Q0045_intron auto59306 Saccharomyces cerevisiae intron
Q0045_intron auto59305 Saccharomyces cerevisiae intron
Q0045_intron auto59304 Saccharomyces cerevisiae intron
Q0045_intron auto59303 Saccharomyces cerevisiae intron
Q0045_intron auto59302 Saccharomyces cerevisiae intron
Q0045_intron auto59301 Saccharomyces cerevisiae intron


Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
chrmt chromosome chrmt:13818..26701 +
Resources