Q0032 (gene) Saccharomyces cerevisiae

Feature Details
Name Q0032
Unique Name Q0032
Internal ID 44100
Type gene
Organism Saccharomyces cerevisiae (yeast)
Cross References
External references for this gene
Dababase Accession
SGD S000007259
Properties
Properties for the feature 'Q0032' include:
Property Name Value
Orf classification Dubious
Display Dubious open reading frame unlikely to encode a functional protein
Note Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data
Annotated Terms
The following terms have been associated with this gene:

Cellular Component

Term Definition
GO:0016021 integral to membrane

Biological Process

Term Definition
GO:0008150 biological_process

Molecular Function

Term Definition
GO:0003674 molecular_function
Synonyms
The feature 'Q0032' has the following synonyms
Synonym
ORF8
Annotated Sequence
Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>Q0032 chrmt:11667..11957 +
ATATTAATAATATATATATTATTTATTATAATGAAAACCTATCCTATATT
ATCCTATCATATAATATCATATCATATTATATTATATCTTATTATATGAT
ATATAAAGTATTCACTCTATATGAGGTTATGATTATTATATAAATCTTAT
TTTATTTTTATTTTTATTTGGACTAATAATAATTATAATAATAATTATTG
ATATGTTCTAATATTAATAAATACATATTTATATTATAATATAAATATTC
ATTTCTTACTAATTAATAAAAAGTTTTTATATTCATTATAA
Relationships

The following mRNA feature(s) are part of this gene:

Feature Name Unique Name Species Type
Q0032_mRNA Q0032_mRNA Saccharomyces cerevisiae mRNA


Alignments
The following features are aligned to this gene
Aligned Feature Feature Type Alignment Location
chrmt chromosome chrmt:11667..11957 +
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
cellular_component GO:0016021 integral to membrane
molecular_function GO:0003674 molecular_function
Resources