Q0017 (gene) Saccharomyces cerevisiae

Feature Details
Name Q0017
Unique Name Q0017
Internal ID 44099
Type gene
Organism Saccharomyces cerevisiae (yeast)
Cross References
External references for this gene
Dababase Accession
SGD S000007258
Properties
Properties for the feature 'Q0017' include:
Property Name Value
Orf classification Dubious
Display Dubious mitochondrial open reading frame unlikely to encode a protein
Note Dubious mitochondrial open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF Q0010
Annotated Terms
The following terms have been associated with this gene:

Biological Process

Term Definition
GO:0008150 biological_process

Cellular Component

Term Definition
GO:0005575 cellular_component

Molecular Function

Term Definition
GO:0003674 molecular_function
Synonyms
The feature 'Q0017' has the following synonyms
Synonym
ORF7
Annotated Sequence
Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>Q0017 chrmt:4254..4415 +
ATGTGTGCTCTATATATATTTAATATTCTGGTTATTATCACCCACCCCCT
CCCCCTATTACGTCTCCGAGGTCCCGGTTTCGTAAGAAACCGGGACTTAT
ATATTTATAAATATAAATCTAACTTAATTAATAATTTAAATAATATACTT
TATATTTTATAA
Relationships

The following mRNA feature(s) are part of this gene:

Feature Name Unique Name Species Type
Q0017_mRNA Q0017_mRNA Saccharomyces cerevisiae mRNA


Alignments
The following features are aligned to this gene
Aligned Feature Feature Type Alignment Location
chrmt chromosome chrmt:4254..4415 +
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
cellular_component GO:0005575 cellular_component
molecular_function GO:0003674 molecular_function
Resources