Q0017 (gene) Saccharomyces cerevisiae
Feature Details
Name | Q0017 |
---|---|
Unique Name | Q0017 |
Internal ID | 44099 |
Type | gene |
Organism | Saccharomyces cerevisiae (yeast) |
Cross References
External references for this gene
Dababase | Accession |
---|---|
SGD | S000007258 |
Properties
Properties for the feature 'Q0017' include:
Property Name | Value |
---|---|
Orf classification | Dubious |
Display | Dubious mitochondrial open reading frame unlikely to encode a protein |
Note | Dubious mitochondrial open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF Q0010 |
Annotated Terms
The following terms have been associated with this gene:
Biological Process
Term | Definition |
---|---|
GO:0008150 | biological_process |
Cellular Component
Term | Definition |
---|---|
GO:0005575 | cellular_component |
Molecular Function
Term | Definition |
---|---|
GO:0003674 | molecular_function |
Synonyms
The feature 'Q0017' has the following synonyms
Synonym |
---|
ORF7 |
Annotated Sequence
Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.>Q0017 chrmt:4254..4415 +
ATGTGTGCTCTATATATATTTAATATTCTGGTTATTATCACCCACCCCCT
CCCCCTATTACGTCTCCGAGGTCCCGGTTTCGTAAGAAACCGGGACTTAT
ATATTTATAAATATAAATCTAACTTAATTAATAATTTAAATAATATACTT
TATATTTTATAA
Relationships
The following mRNA feature(s) are part of this gene:
Feature Name | Unique Name | Species | Type |
---|---|---|---|
Q0017_mRNA | Q0017_mRNA | Saccharomyces cerevisiae | mRNA |
Alignments
The following features are aligned to this gene
Aligned Feature | Feature Type | Alignment Location |
---|---|---|
chrmt | chromosome | chrmt:4254..4415 + |
GO Assignments
This gene is annotated with the following GO terms.
Category | Term Accession | Term Name |
---|---|---|
biological_process | GO:0008150 | biological_process |
cellular_component | GO:0005575 | cellular_component |
molecular_function | GO:0003674 | molecular_function |
Resources