maker-scf1117875582023-snap-gene-13.67-mRNA-1 (mRNA) Pythium ultimum

Feature Details
Name maker-scf1117875582023-snap-gene-13.67-mRNA-1
Unique Name maker-scf1117875582023-snap-gene-13.67-mRNA-1
Internal ID 39631
Type mRNA
Organism Pythium ultimum (Pythium ultimum)
Annotated Sequence
Legend: polypeptideexon
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>maker-scf1117875582023-snap-gene-13.67-mRNA-1 scf1117875582023:1369887..1371392 -
ATGGCGTTCGATGCAGCCGGCGCGTCCAGTCTGGAGCAGTTCACGCTGCT
CGCCAAGAACGCGCGTGGGCGAGCGTGCGTGGCGCTGGTCCAGCAGGTGC
TGACCAACAAGAAGCTTTTCGTGTTCCGAGAGCTGCTCGACATGCCCAAT
GTCCAGGCGCTACAGGATACGGAAAACCACGGCTACTACGAACTGCTCAA
GATTTTCTGCTTTGGCAACTACGGCGACTATCTCGGTATGCATGCACGCC
TTGTTTTGTGTTGGTTTTGCTGTGTGTGAATGAAGAGACCACATGTGCTC
ACGTGCATGAATGTGGACTGTGCTGACAGCGCGCAAGGAGGAACTGCCAG
CGCTGACCCCACAGCAGGTCCAAAAGCTTCGAAAGCTCACTGTTGTGTCG
CTTGCCCACAGATACAAGGTAAGTCCCGGTTGCTTTTGAGTCGCGAAAGA
GCAAGGTAGACATACTGGCGTGAACTTTTTGGAGCTGACTGAATGATCGT
GCAGCTCGTGCCGTACAATGTGCTGATGGAAGGATTGGATGTACCCACTG
TGCGAGAACTCGAAGACATCCTGATCGAGACTATCTATTCGGTGGGTGCT
TGAACTCTATTTTGCAAGCATGTGACCACGTACGTTGACGTTTGTTTTGT
ATGGCTACTATATGCGAATGCTTTAATAGGGTCTCGTGCAAGGGAAACTG
GACCAGAAGTCGCAAGCTTTTGTTGTCAAGTACGCCGTTGGACGCGACAC
CCAGCACGAAGATATCGACAGTATGATCGCAAAGCTTACGAGCTGGTACG
ATACGCGTCTGTTGCATATTCGAACGAGTTCGGACGGTATGATCGAGTAT
TTGACTGTGGTTGCAACAACTCACCTGCTTCGTTCTTGTGATAGGAGATC
GGAAGCGTCGACTATCTGCACGAAGATCAACGACATCCTCATGTATGAGC
TCACATAGTAGCGCCAGGAAAACAAAGGACTATCTTCTCGTTGGTACTCA
CCTTTTGCGACTTTGTCGTTATTTGACAATACAGTTTAGCTGACAACTTG
GCGGAGAATGAAAAGGTCCGTGACGAATCGATCCGCTCGAAGATCGCGTC
TCGCGCCAACAGCACCGAGCGTGGAGGAAAAGTCTTTGGAGGAAGTTCCA
TTTCGGGCCTTCGCGGGAACGACGACTATGGCATGTACCAAGATGCCAAT
TACAGCAACGGGCGTCGTGGGTGAGTGGCTTGCGCTTTGTGCATTGAATC
GTGATCTATTCCTTGCTGCGTGACTCCATATATCTGACTCTGCTTGTTAT
CTACTCTTTGGCTTTCTCTCCCTGCAGAATGCCTGGAGGCAAGCAGCGTC
TGCACAACATGCCCCGCAAAGGACGTCTCTAAAGCAAAATAAGCTCATGC
GGTATCTTGCAAGTTGACGTGACATGGTTGGGACAATGTGTTTGACCCAA
TAACCCACTTTGTGGAAGAATCCCTCAATTCCAACTGGGTTATTCTGATA
ACAGTT
Relationships

This mRNA is part of the following gene feature(s):

Feature Name Unique Name Species Type
maker-scf1117875582023-snap-gene-13.67 maker-scf1117875582023-snap-gene-13.67 Pythium ultimum gene


The following polypeptide feature(s) are derives from this mRNA:

Feature Name Unique Name Species Type
polypeptide-auto43516 auto43516 Pythium ultimum polypeptide


The following exon feature(s) are part of this mRNA:

Feature Name Unique Name Species Type
maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1309 maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1309 Pythium ultimum exon
maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1308 maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1308 Pythium ultimum exon
maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1307 maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1307 Pythium ultimum exon
maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1306 maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1306 Pythium ultimum exon
maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1305 maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1305 Pythium ultimum exon
maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1304 maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1304 Pythium ultimum exon
maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1303 maker-scf1117875582023-snap-gene-13.67-mRNA-1:exon:1303 Pythium ultimum exon


Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
scf1117875582023 contig scf1117875582023:1369887..1371392 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
maker 2013-03-08 .927984
Resources