maker-scf1117875582023-snap-gene-13.66-mRNA-1 (mRNA) Pythium ultimum

Feature Details
Name maker-scf1117875582023-snap-gene-13.66-mRNA-1
Unique Name maker-scf1117875582023-snap-gene-13.66-mRNA-1
Internal ID 39570
Type mRNA
Organism Pythium ultimum (Pythium ultimum)
Annotated Sequence
Legend: exonpolypeptide
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>maker-scf1117875582023-snap-gene-13.66-mRNA-1 scf1117875582023:1365908..1366446 -
AGAACTTAATTCAAAATGGTCGCTTCTTCTGGTCAACCAACTCGTCTCTA
CGTGAAGGGTGTCTTCGTGGGTTACAAGAGGTGCGTCACCTGGAGCTACG
CGCGCGCGTTGTTGCTGTTCTTTCTTCAGAGTTGCTCACCGTTTCTTTTG
TCATTCTTGTTGCTGTCCAACAGAGGTCTTCGTAACCAGTACTCCCACAC
CTCACTTATCAAGATCCAAGGTCTTCAGGATAAGAAGGATGTTGACTTCT
ACCTCGGTAAGAAGATCGCCTACATCTACAAGGGCAAGACCTTGAAGAAC
AACTCCAAGTTCCGTGTGATCTGGGGCAAGGTCACCCGCGCCCACGGCAA
CAACGGTCTTGTCCGCGCCAAGTTCGCCAAGAACCTTCCAGCTGAAGCCA
TCTCCGCCTCGGTGCGCGTGATGCTCTACCCAAGCCGTGTTTAGATTCGT
AGGACGTGGTAAATGATGATGAATACGAAAGAGAGGGGTAAGGACGAGTT
CCTGTTTTTCAGAGAAGAATCCCACCATTTCCGGACTTT
Relationships

This mRNA is part of the following gene feature(s):

Feature Name Unique Name Species Type
maker-scf1117875582023-snap-gene-13.66 maker-scf1117875582023-snap-gene-13.66 Pythium ultimum gene


The following polypeptide feature(s) are derives from this mRNA:

Feature Name Unique Name Species Type
polypeptide-auto43514 auto43514 Pythium ultimum polypeptide


The following exon feature(s) are part of this mRNA:

Feature Name Unique Name Species Type
maker-scf1117875582023-snap-gene-13.66-mRNA-1:exon:1257 maker-scf1117875582023-snap-gene-13.66-mRNA-1:exon:1257 Pythium ultimum exon
maker-scf1117875582023-snap-gene-13.66-mRNA-1:exon:1256 maker-scf1117875582023-snap-gene-13.66-mRNA-1:exon:1256 Pythium ultimum exon


Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
scf1117875582023 contig scf1117875582023:1365908..1366446 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
maker 2013-03-08 .927984
Resources