maker-scf1117875582023-snap-gene-0.38 (gene) Pythium ultimum

Feature Details
Name maker-scf1117875582023-snap-gene-0.38
Unique Name maker-scf1117875582023-snap-gene-0.38
Internal ID 28288
Type gene
Organism Pythium ultimum (Pythium ultimum)
Annotated Sequence
Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below. The colors in the sequence below merge when types overlap.
>maker-scf1117875582023-snap-gene-0.38 scf1117875582023:56030..58052 -
ATGGCGGGCGTGAAGAAGGAGCTGCGCAAGCAGATCGCGGCGGTGCTCAA
GGCTACCGAGGCCGCGGAGGTTGCGCTCCAGAGCCAGCAGCTCACGGAGC
GCATCTACGCGCTCCCAGAGTTCCGCAACGCAAAGGTGCTCAGCGTGTAC
CTCGAAATGCCCAAAGAAGCGGCCACGCGTGGACTGTTGACGGCTGCTTT
CGAAGCGGGCAAGAAAGTATACGTGCCTAAAATCACAGGCCGCGGAGCGG
AGGACCTCAAGATGGTGCAAGCCCTGTCCATGAATGACATTAACACCTTC
CCAAAGGTTCGCCTTTGCTTCTGCTGGAGCTTGTATGTATGTTATGATGA
GGTGCTAAACGCTGATGATCTTTCGCCCAGGACAAGTGGCAAATTCCTGA
CCCGCCATTGACGAGTGCAAGTGGAGACGCGCGAGAAGACCCCATTGCGG
CCTTGGACTTGGAGCTCGTGCTAATGCCGGGGGTAGCTTTTGATCGCTCG
GGTGGCCGATTGGGTCACGGAAAGGGCTATTACGGTAAGAGATTTGACTG
CATCTCAGCTTCCATTTCTGCTGTCTTTCGCCACAACTCGAATGTGTGTA
TCTCGTTTCAGATTCCTTTCTGCGTCGACTGGGCGAGGCGTACGCGAAGA
GCGGCAAGCCACTGCCAACGACGATCGTAAGAACACTTGTGTGGCTTTGA
GTGCAGATCTGACAGCTGAGTGACAATGGCTGATAATGCGTGTGCATGTG
TTTGGCAAAAGGGACTCTGCCTGTCGTGTCAGCTCGTGGACCAAGTGCCG
CTGTCTCCGCACGACAAGATGCTCGATATCATCGTCACGCCCGAGGAAGT
GGTGCGTCCATGATCATAGTCTCCATTAACCGAGTCGCTAATAAACGAGC
AAATTCAGATCTTGCGTATCTTGTCGAGTTAATCCGTTTTGATTGGCTAA
TTTAGTATCGTGAGATGCTTTATTGGCTGAAAATAGAGGTGACTCAGCGC
TGGCCGCGTATCGTGCTCATTTGGCAATTCGATCCGATGGGCAAGCACGG
CGTGTTGTATCTGTTGTGTGTGGTGCTGCTCGTGGCGGTGGCCGCGGCGC
AGGACCTCTATGAGGTGCTGGGCGTGTCTGCATCTGCGACGCCTGCGCAG
ATGAAGAAGGCGTGAGTGTGTGTTGCGTCGCTTTCCTCCTCGCACGCGAG
CCAGCCTGCTCACTCACCTCCTTCGTTCACCACACGTTATATAGATACCG
CAAGCTCTCGCTCAAGTACCACCCGGACAAGCAAACGGGCGAGACCCGTG
AAGCCGTGAAGGAACAGTTCGTCAAGGTCACGAACGGTGAGTGGCTCGTG
TCGCTTTTCTAGATATGTGTCAGCAAGGCTGGCCAGCTCATTCAACTCAT
TGTGTCGTCCTATTGCAGCGTACCGCGTGCTTTCGGACCCTGCGCGCCGT
GAAAAGTACGACTTGTATGGCATCGCCGACGAACAAGAGTTCAAGTAAGT
CACGGAACTGTGTCTGTGTATCAGTTGGAAAGACGGAGTATCGTAATGCA
TTTTTGCCTGATGCGGTGCAGGAATTTCGACGAAGCGCTTCGTTTCTCCC
ACGAAGGCGTGGAAGACTCGCTTCTCAACTGGCTCGGTCTTGTCGCGATT
CTTGCTATCGGCATCGTGCCGATCGTGATCATGCAGCGCAATCGAACGAA
GCCTCTCAAAAAGAGACGTGAGGTATTTTTCTAATAGTATGTACAACTGT
GCGTGGCTTCCTCATTGTGATGTTGCTGTCTTGACTGTGCTTGTAGGCCC
TGCGAAGCCTGTCAAGAAATAGACTCACGGCAACCTCGACCAACAACTTC
AAGCAGGACTTCACCGCAAAGAGACGTCAATACGTGAACAACCCAGGACT
GGCGAACCAGTGAGTGGGGAATTCGAATTGCTGTCGCTTTGCGCAGAGTC
ATCATGCGATTTCGTGGGGGCGCGAAAAATGATCCATAAAGAACAATTGC
AGAATGCCCTTTGCATTTTTTTT
Relationships

The following mRNA feature(s) are part of this gene:

Feature Name Unique Name Species Type
maker-scf1117875582023-snap-gene-0.38-mRNA-1 maker-scf1117875582023-snap-gene-0.38-mRNA-1 Pythium ultimum mRNA


Alignments
The following features are aligned to this gene
Aligned Feature Feature Type Alignment Location
scf1117875582023 contig scf1117875582023:56030..58052 -
Analyses
This gene is derived from or has results from the following analyses
Analysis Name Date Performed
maker 2013-03-08 .927984
Resources